104170angel 104170angel

11-12-2022
Biology

contestada

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated DNA strand) GTAGTAGTAGGAGTAGTAGTA. What type of mutation is illustrated? A insertion B Translocation C Substitution D Deletion

Respuesta :

Otras preguntas

what is national library week?

What was the relationship between the temperance and suffrage movement

A body of mass 2 kg is moving in the positive X-Direction with a speed of 4 m/s collides head on with an another body of mass 3 kg moving in the negative X-Dire

Calculate the de Broglie wavelength of an electron traveling at 3.0 × 107 m/s (me = 9.1 × 10-31 kg).

Which causes fermentation?A. AntibodiesB. AntigensC. MicroorganismsD. Antibiotics

what does 'keep your head' mean?

what do you set the oven to when baking palmiers

The sum of the digits is 11. When rounded to the nearest hundred, it's 500. Rounding to the nearest 10 makes it 530. What's the number....

what do you set the oven to when baking palmiers

What value was there in predicting the properties for gaps in Mendeleev's table?