sunnyluvrena sunnyluvrena
  • 12-12-2022
  • Biology
contestada

5'
GCCATATATATAATTGTGGCCATGGGGCAAGTCCCCAAGGCGACCCTATAGGGGGCG 3'
3' CGGTATATATATTAACACCGGTACCCCGTTCAGGGGTTCCGCTGGGATATCCCCCGC 5'


18. Explain the type of nucleic acid portrayed in the sequence of nitrogenous bases displayed
above?

Respuesta :

Otras preguntas

Evaluate 4s2 for s = s 1/4
Can someone please answer. There is one problem. There's a picture. Thank you!
Which organelle would the Spirulina bacterium have provided?
what should you fo to solve the problem of exposure to your mom's second hand smoke in the house?
Why are plasmids so widely used in recombinant DNA studies? A. because they naturally contain much foreign DNA B. because they can be used to transform bacteria
What must be given to prove that CJG ~ CEA
An experiment looking at structures smaller than a cell would most likely employ a _______. a. dissecting microscope b. transmission electron microscope c. sc
3 times the measure of an angle is 14 less than the measure of its complement. What is the measure of the angle?
What is one country we will visit on our cruise?
8. Use the following sentence to answer the question. Her sketches are unusual because of their unusual perspective, radical use of color, and she uses unexpect