janelmorrcole janelmorrcole

15-01-2024
Mathematics

contestada

△PBU can be mapped onto triangle, G, Z, D△GZD by a rotation. If m, angle, P, equals, 38, degreesm∠P=38 ∘ , find m, angle, Zm∠Z.

Respuesta :

Otras preguntas

Wha kind of sequence is the pattern 1, 6, 7, 13, 20,

A boat travels north across a river at a velocity of 22 meters /second with respect to the water. The river's velocity is 22 meters /second to the east. What is

help please!! picture included!!

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10

According to the general equation for conditional probability, if P(ANB)= 3/10 and P(B)= 4/5, what is P(A|B)?

Which of the following should take place in the completing stage when writing an instant message?a. Creating a content outline b. Minimizing the number of recei

Question on packer due tomorrow also can you please show work? Question: the perimiter of an isosceles triangle is 75mm. The two congruent sides are each 10 mm

I need help with this please!!!!

how do you write 13 in minutes. ---------- 20

For guitar class pls help!!!