noah602 noah602

15-02-2024
Medicine

contestada

Development of malignant melanoma is associated with which risk factor?

a) Sun exposure
b) Bacterial infection
c) Genetic mutation
d) Chronic stress

Respuesta :

Otras preguntas

. In 2000, KFC® and A&W® restaurants successfully merged because each had a strong signature product: KFC’s fried chicken and A&W’s root beer floats.

Being physically active will improve your mood.Immersive Reader True False

Can a number be a natural number but not a rational number? Explain your reasoning. PLEASEE HURRRYYY

Under the right conditions, a seed can germinate in the ground. What is the best synonym for "germinate?"

yay my account is unbanned

HELP !!!!!40 POINTS AVAILABLE 2. d+g/h. When d=29, g = 16. and h=9 (1 point) A.8 B.2.375 C.5.375 D.5

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTA

92. Macrocycles, mesocycles, and microcycles are a part of which training protocol? AO Synchronization B. Optimization C. Periodization D. Stabilization

PLEASE HELPP DUE TODAYYYY:what is the LDC least common denominator

7.385 rounded to the nearest tenth