haileyyyyyyyy3928 haileyyyyyyyy3928
  • 15-02-2024
  • Social Studies
contestada

The concept of protecting the natural resources of the planet while still achieving corporate profitability is called?
1) Sustainability
2) Conservation
3) Environmentalism
4) Green business

Respuesta :

Otras preguntas

Not all Pullman workers agreed to give up their union membership. Read the quotation from a Pullman worker on the right. Which statement best expresses the auth
Replicate the following DNA strand: 5' ATTGCGAACTGCGAGGACTTC 3'
A DNA sequence that helps to reduce or shut off the expression of a nearby gene.
The brain is made up of: a. 2 cerebri, hemispheres b. 2 cerebelli hemispheres c. the brainstem
How high can you throw a ball? What variables might affect the answer to this question?
Express in simplified exponential notation. x3 • x5 =
A technique called peptide nucleic acid FISH (fluorescent in situ hybridization) is used to identify 16s RNA sequences, but is a time consuming process since th
Why were west African empires prosperous
You’ve just met with a new client. They’re a small business owner who has been managing their books with a number of spreadsheets up to now, but you have convin
Essay favorite sports