Alisabeth1811 Alisabeth1811

15-02-2024
Social Studies

contestada

Group identity refers to the extent to which people feel their group membership is an important part of who they are. Relational identity refers to _. Collective identity refers to _.
1) individual identity
2) personal identity
3) social identity
4) cultural identity

Respuesta :

Otras preguntas

a^3= 216. What is a? (With steps)

In which region of the United States is a hurricane likely to inflict the MOST amount of damage? The Midwest The Northeast The Northwest The Southeast The

Effective presentations are: Have a central message Colorful and exciting Have many messages Are influence by a setting Created for a specific audience

How many numbers between 1 and 100 are divisible by 5 or 8

Explain why you can find 5÷1/3 by multiplying 5 by 3.

a carbon atom with 6 proton and 6 neutron in its nucleus is called carbon-12 the carbon atom with 8 neutrons is called what

Which values of a, b, and c are possible? A=6,b=1,c=pi/3 A=6,b=3,c=pi A=3,b=1,c=pi/3 A=3,b=6,c=pi

Qué le permitió hacer el aburrimiento a Teresa Belton, según la fuente escrita

Using complete sentences, explain how the Chinese communists were treated under the rule of Chiang Kai-shek What was the Long March, and what were its results?

need mRNA AMINO ACIDS 1.AATACGGGGGCGTAACCACTA 2. GCTAGTACGTGCACATTAGAA