mhsjdm84061 mhsjdm84061

11-03-2024
Mathematics

contestada

Which of the following expressions is equivalent to the verbal expression 'the quotient of x and 5'?

A. x/5
B. 5/x
C. x+5
D. 5x

Respuesta :

Otras preguntas

Draw lines to connect each repeating decimal on the left with an equivalent fraction on the right . Hurry !!

A person asks you if you would volunteer to counsel delinquent youths at a detention center for one year. When you refuse, she asks you if you could supervise t

To make IPv4 addresses a little easier for human beings to understand, the 32-bit binary addresses are represented by dotted decimal notation. T/F

why do YOU read? one paragraph.

What are dust mites?

A deamination occurs on the cytosine residue in the following DNA sequence. This cytosine residue happens to be methylated on the 5-position of the aromatic rin

The radii of the sodium and potassium ions are 102 pm and 138 pin. respectively. Which compound has stronger ionic attractions, sodium chloride or potassium chl

Kevin scores on the first for science test are 88, 92, 82 and 94. What a score must he earn on the fifth test to an average of 90? Define a variable write an eq

The more difficult it is to enter the task environment: (A) the more competitors an organization faces.(B) the harder it is to obtain customers.(C) the easier i

Replicate the following DNA strand: 5' ATTGCGAACTGCGAGGACTTC 3'