nextgeneration505 nextgeneration505

14-11-2019
History

contestada

Where did the Trail of Tears begin?

A. New Echota
B. Charleston
c. Tahlequah
D. Cape Girardeau

Respuesta :

Аноним Аноним

12-12-2019

Answer:

Charleston

Explanation:

apex

Answer Link

Otras preguntas

The separation of populations by a barrier such as an ocean is called

Better to be a free bird than a captive king

Discuss the impacts of biotechnology on individuals, society and the environment.

Apply the commutative property to 13 × 7 × 21 to rearrange the terms and still get the same solution

How did northerners react to the Compromise of 1850?

What is a Agricultural waste used as fuel is an example of a?

The participle inflectional morpheme ending is used only with? 6) conjunctions7) adjectives8) adverbs9) nouns0) verbs

How does a chemist count the number of particles in a given number of moles of a substance?

What was one effect of american efforts to achieve peace in Israel?

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se