drizzyizzydem816 drizzyizzydem816

15-11-2019
Physics

contestada

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Respuesta :

15-11-2019

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

Answer Link

Otras preguntas

The key strength of the public corporation is/are: a) Limited liability for shareholders b) Ability to raise capital through stock offerings c) Separate legal e

Why can both carbon dioxide and water be considered a greenhouse gases?

What is the length of the brace

Roman republic study guide, 4th grade, Unit 4: chapter 1. What natural defenses protected Rome from invasion?

________ would be considered a marketer-dominated source of information discovered during an external search during the purchase decision process.

What usually indicates liver problems or blockage of biliary ducts?

Read this excerpt from ''A Quilt of a Country'' by Anna Quindlen. There is that Calvinist undercurrent in the American psyche that loves the difficult, the dema

Refer to exhibit 17-5. Using weights of .4, .3, .2, and .1, what is the four-week weighted moving average forecast for April, week 1?a)206.4b)208.4c)204.1d)210.

The competition and tension among countries resulting from imperialism contributed to the start of WWI.

A particular recessive allele is known to be lethal when present in the homozygous condition (aa). the number of offspring born with this lethal disease is 1 in