belekathyln77 belekathyln77

11-12-2019
Mathematics

contestada

Jaun has 105 feet of rope he needs to cut into sections 7/8 feet long . how many sections can be cut

Respuesta :

emmaleongningyi emmaleongningyi

12-12-2019

Answer:

120

Step-by-step explanation:

105÷7/8= 120

Answer Link

Otras preguntas

expand the expression: -5(4-7c)

Damien has been meeting with his therapist three days a week for over a year. His sessions are spent talking about past experiences, identifying recurring theme

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to d

Imagine you were animating an elephant. Name at least THREE major places you would need to add edge loops to besides the legs and neck, and explain why those pl

What is the most popular state , which has 52 representatives

what is the median of this data set

A. Client reporting incisional pain of 8 on a scale of 0-10 with a respiratory rate of 25/min who had a right pneumonectomy 12 hours ago B. Client with a left p

if f(x) = -9x – 7, then f-'(x) = Enter the correct answer.

How can you tell the difference between a muscle strain and muscle soreness?

1. Which of the following best describes what we mean by resources in economics? Natural resources like natural gas and trees The ability to handle a situation