slimedawgg
slimedawgg slimedawgg
  • 12-01-2020
  • Mathematics
contestada

Can you guys factor this problem completely for differences of squares?

Can you guys factor this problem completely for differences of squares class=

Respuesta :

guskarose
guskarose guskarose
  • 12-01-2020

a² - b² = (a - b)(a + b)

49x² - 9 = (7x)² - 3² = (7x - 3)(7x + 3)

Answer Link

Otras preguntas

3 most important things about the Salem witch trials
what type of chemical reaction involves 2 or more elements combining to form one?
A class has a total number of 39 students. The number of males is 7 more than number of females. How many males and how many females?
Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds
Socialization is the act of hanging out with friends and or families. a. True b. False
how to multiply fractions
Read the following sentence from Jack London's White Fang: One Ear was uttering quick, eager whines, lunging at the length of his stick toward the darkness, and
Find the sales tax of 5% on a purchase of $156.34 $7.82 $8.52 $9.33 $10.56
1. What is the value of x? Show all of your work this is a triangle! The base is the longest side! width is the very bottom! Base= √117 cm Height= x cm Width= 6
A light year in the distance that light travels in one year