mmerlos83 mmerlos83

12-05-2020
Mathematics

contestada

What is one-third of $4.00

Respuesta :

wegnerkolmp2741o wegnerkolmp2741o

12-05-2020

Answer:

1.33

Step-by-step explanation:

Take the amount and divide by 3

4.00 /3 =1.33333333

We round to the nearest cent since this is money

1.33

Answer Link

kaufmann kaufmann

12-05-2020

Answer:

$1.3333

Step-by-step explanation:

1 / 3 × $4.00

4 / 3 = $1.33333

Answer Link

Otras preguntas

Can someone help PLS

Given that a car can drive 92 miles with 4 gallons of gasoline, how many gallons does it need to drive 253 miles? 5 gallons 7 gallons 9 gallons 11 gallons

why did the newly eatablished democracies of europe have trouble surviving in the years after world war 1

Draw a punnet square for a female carrier of sickle cell with a wildtype male without the sickle cell allele. will any of the offspring have sickle cell?

"I look upon England to-day as an old gentleman who is traveling with a great deal of baggage, trumpery which has accumulated from long housekeeping, which he h

What is the value of x in the following equation: 2x+4x=15 ?

What was the main goal of the settlement house movement?

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

Simplify the expression. (7x + 1/2) + (4x − 3 1/2)

James coleman's research on segregated schools, which provoked much opposition, some of which was violent, resulted in the policy of: sociology