Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

Mr. Wilhelm, Mr. Ransick, and Mrs. Johnson teach three different grades (6th grade, 8th grade, 10th grade). Mr. Ransick's students are older than Mr. Wilhelm's

how do you solve this????

how can people avoid avoid being tricked by faulty persuasion tactics

Select the correct inference of the given passage from "The Cask of Amontillado." "I continued, as was my wont, to smile in his face, and he did not perceive t

If the point (7, 3) is on the graph of an equation, which statement must be true? A. The values x = 3 and y = 7 make the equation true. B. The values x =

How did the peloponnesian war differ from the persian war? a. the persian war was more of a civil war b. athens refused to fight in the persian war c. the pe

The weights of 2-pound bags of Best Dog Food are approximately normally distributed with a given mean mc020-1.jpg and standard deviation mc020-2.jpg. According

Alicia planted 45 tulip bulbs last year. This year she plans to plant 65 bulbs. Find the percent of increase in the number of tulip bulbs to the nearest tenth

Without mitosis, the body would not be able to

Solve by addition ANSWER NOW