sushanaryal01
sushanaryal01 sushanaryal01
  • 11-07-2020
  • Physics
contestada

The acceleration due to gravity on the moon is 1.67m/s. What does it mean?​

Respuesta :

TheSection
TheSection TheSection
  • 11-07-2020

Answer:

It actually is 1.67 m/s/s which means that if you are falling, the moon gravity will increase your falling velocity by 1.67 m/s every second.

If you are falling on the moon from a height. The speed at which you will be falling will increase by 1.67 m/s every second

Answer Link

Otras preguntas

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
Select all of the following that are part of the pre-writing step of the writing process. Researching Planning Note taking Thinking
what budgeting option is best used only with limited resources and expenses
PLEASE HELP ASAPA construction crew is lengthening a road. The road started with a length of 57 miles, and the crew is adding 4 miles to the road each day.
What is the primary purpose of the detailed descriptions Barry Holstun Lopez includes in the excerpt from Of Wolves and Men? (1 point)
Baroque art and architecture developed in the seventeenth and eighteenth centuries, mainly in Europe. In which European country did Baroque art originate?
when does robinson crusoe orginally set out to build a castle
How many halves are in 3 5/10
Which theme from the Gettysburg Address is developed in these lines from the speech? The world will little note, nor long remember what we say here, but it can
what is 2/3x -5=1 with variables on the same side?