julia82
julia82
13-09-2016
Spanish
contestada
Answer 1-9 please. I don't understand
Respuesta :
Valxntina
Valxntina
13-09-2016
1) yo soy delgado 2) tu eres guapo 3)-not sure 4)Nicolas y Emilio son altos y morenos 5)Felipe y yo somos amigos buenos 6) Patricia es paciente y seria 7)ustedes son trabajadores 8)-not sure 9)Lola y Leticia son intelligente y divertidas
Answer Link
VER TODAS LAS RESPUESTAS ( 65+ )
Otras preguntas
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
i need help please help me
Eisenhower's secretary of state, john foster dulles, announced an updated version of the doctrine of containment called "massive retaliation." identify the stat
Which of the following can help an entrepreneur enter the business market of a different country? A. Creating a Web business B. Changing to a different lifestyl
Because the fruit bowls were new to the market, dole's initial advertising objectives focused on ______ its audience about the product.
Suppose you apply a flame and heat one liter of water, raising its temperature 10°C. If you transfer the same heat energy to two liters, how much will the temper
Can some one explain to me how I do it step by step to understand and with answer what is the area and perimeter and type please
Find the area of the following polygons: Given: AC = 12, AD = 16
Joanna has a board that is 6 feet long. She cuts it in to pieces that are each 1/4 foot long. Which equation represents the number of pieces she cut?
An ____ or scar appears at the base of the petiole where the petiole attaches to the stem
