i1nizam1i
i1nizam1i i1nizam1i
  • 13-10-2020
  • Biology
contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA



What is the complementary DNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the complementary DNA sequence for the DNA strand above class=

Respuesta :

KurdishPotato
KurdishPotato KurdishPotato
  • 13-10-2020

Answer:

Option D)

Explanation:

In the DNA strand A comes accross Tç and C comes across G

The option justifies this rule is D)

Answer Link
87187 87187
  • 13-10-2020

The picture doesn't work for me.. sorrry

Answer Link

Otras preguntas

Cause of the English settlers won the war and gained control of most of New England
What is the definition for coast
three traits that might be desired in sheep
Why did people want to restrict immigration to the United States? Choose all answers that are correct. A. Many people believed that rich immigrants would end up
5 physical properties that distinguish water from most other compounds
one of the main uses of satellites is
The teacher separated her class of twenty-eight students into two groups. One group has 4 more than twice as many students as the other group. How many students
What does the alt code 158 "₧" mean?
which statement is true about asexual reproduction? A) it occurs in most prokaryotes B) It can occur only by fission C) Its involves two parents D) It is not v
In this food chain, which organism would be the primary producer?