9pdhcx4saq 9pdhcx4saq
  • 11-11-2020
  • Chemistry
contestada

Explain how Mendel used the F1 generation to conclude that genes are inherited.




Answer the Questionnn


science

Respuesta :

queenbabydoll420
queenbabydoll420 queenbabydoll420
  • 11-11-2020

Answer:

studied the generation to see there traits

Explanation:

Answer Link
kyler1824
kyler1824 kyler1824
  • 11-11-2020
studied the generation to see their traits i’m sure
Answer Link

Otras preguntas

Simply each expression !! (Only do the ones that are underlined but you can do the rest if you’d like i guess)
Glomerular Filtration Rate: A. - It is the pressure exerted by the proteins in the blood. B. - It is the volume of filtrate formed each minute by the combine
RNA interference can be a mechanism of defense against viral infection as well as for regulation of gene expression. RNA interference can be a mechanism of defe
________ conflict is defined as interpersonal opposition based on personal dislike, disagreement, or differing styles. For example, Sasha and Alexandra, who bot
What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA
Are tRNAs specific for amino acids? What does tRNA stand for? What does it do?
(fill in with the correct words)En está clínica ___ varias lenguas.(A) es escribe(B) se sabe(C) se hablan
How many thirds of a hallway are there to decorate in 5 hallways
Evaluate the expression 3(x - 1)2 + 2x - 7 for x=3
When a calcium ion binds to troponin: A) tropomyosin moves out of the groove between the actin molecules. B) active sites on the myosin are exposed. C) actin