ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

Which of the following is an ongoing problem in Brazil? A. a highly educated population with no job market B. class riots between the wealthy and poor in cities

A submarine that is 245 feet below sea level descends 83 feet and then ascends 103 feet. What is the location of the submarine compared to sea level?

Identify the choice that best completes the statement or answers the question. Over several years, a population of bats that inhabits a cave decreases. Which of

what does the verb deplored mean as it appears in the text ? write your best definition of deplored here, along with a brief explanation of how you arrived at i

7 x [{9+8)-(12-7)] answer

Why was the colony of Azilia not settled? A) There was a lack of money and Interest. B) The Native Americans burned the settlement. C) Montgomery died and the c

the value of 7y–2 is 10 more than the value of 2y

what does it mean to be a U.S citizen?

A high number of white blood cells over a long period of time is a sign of A) Leukemia B) HIV C) Influenza D) Pneumonia

list of the earliest invention in human history?