cheyyy5 cheyyy5

14-01-2021
Biology

contestada

1-5 For the following DNA sequences, replicate the DNA
1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Respuesta :

angelomontoya angelomontoya

14-01-2021

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

Answer Link

Otras preguntas

How did China flourish during the Ming Dynasty? a. Religiously by building temples b. Economically by trading C. Culturally with cultural interactions. d. Both

BEBE Use the activity series below to predict whether the following reactions will take place. 803 F2 > Cl2 > Br2 > 12 Cl2 + 2Rbl - 2RbCI+ 12 12 + NiBr

Ashley began a new fitness and wellness program. After 30 days she weighed 124 pounds. After 60 days she weighed 108 pounds. If the relationship between the num

Mean Versus Median 1) Sarah and Andrew were comparing prices of their favorite energy bar. Eight grocery stores sell the PR energy bar for the following prices:

Which of the following helps you overcome the speed differential that occurs when taking notes?

What would you do if you do not understand the directions in a test

What is the value of x? The answer can be a decimal! (5x - 25) ° (3x + 9°

In 1982, Wayne Gretsky set a record for the greatest number of hockey goals in one season with 92 goals. If a player has scored 60 goals this season and average

The internet's data pathways rely on what kind of hardware device to route data to its destination? O IP addresses O servers O ISPs routers

Which proposals were part of President Johnson's efforts to end poverty in the United States? Choose all answers that are correct. Food Stamp Program Peace Corp