cheyyy5 cheyyy5
  • 14-01-2021
  • Biology
contestada

1-5 For the following DNA sequences, replicate the DNA
1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Respuesta :

angelomontoya
angelomontoya angelomontoya
  • 14-01-2021

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

Answer Link

Otras preguntas

which planet is known as the red planet​
Although your project has been accepted by the customer, the contract with the system vendor specifies that it will support the system for three months after ac
use the figure to find x
PLS HELP 10 POINTS!!! Identify the term whose coefficient is -12 in the expression: 98x – 12xy2 - 15xy2
in the given figure poq is a line. if x=30 then find qor and ros​
y=5/3x + 3 in ordered pairs
Three examples of risks in business​
Information Technology QuestionWhat is the best topic in Information Technology ever?.​
Recyclable plastic products will have the following code molded into the bottom: Letter A Letter B Letter C Letter R, for recycle!
2. Sulfur dioxide gas (SO2) reacts with excess oxygen gas (O2) and excess liquid water (H2O) to form liquid sulfuric acid (H2SO4). In the laboratory, a chemist