betzabelnapolesaguia betzabelnapolesaguia

15-01-2021
Mathematics

contestada

please help me whit these

please help me whit these class=

Respuesta :

Аноним Аноним

15-01-2021

Your answer should be A

sorry if it isnt right

mark brainliest-?

Answer Link

Otras preguntas

Based on the graphic organizer, which paragraph is the best summary? A. When the narrator thinks of the hometown from her youth, all she remembers is dust. She

What was the basic gain in a direct democracy?

Claire marveled at her little brother’s flawless dive. It looked effortless now, but she knew he had spent weeks perfecting the arch of his body and the point o

Fran Fran works due north of home. Her husband Alan Alan works due east. They leave for work at the same time. By the time Fran is 5 miles from home, the di

Please Help with this fast!!Thank you!PLEASE

Customers can pick their own cherries at cherry Hill Farm. They pay $4 to enter the farm and $3.50 per pound for the cherries they pick. Write an equation to mo

how william pitt's goals at the beginning of the war compared to what was achieved

Contaminemos menos, el calentamiento global continúa siendo un tema preocupante. aunque para que ____ llueva, se reducirá el problema de la sequía. tan pront

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

The concept of voting rights is based on