christina3420 christina3420
  • 12-02-2021
  • History
contestada

what is the reason of ww1?​

Respuesta :

yourlocalawesomeness
yourlocalawesomeness yourlocalawesomeness
  • 12-02-2021

politics, secret alliances, imperialism.

Answer Link

Otras preguntas

Prove algebraically that (4n+ 1)²- (2n-1) is an even number for all positive integer values of n.
Which of the following is something computer scientist would do ​
What is an example of an interpretation? O They appeared happy. O It smelled like cinnamon. O It sounded like birds. O It tasted like soap. Question 4
Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG
Which theorem or postulate could be used to prove the congruence of the triangles?
. Назвать фольклорные источники литературной сказки. второй половины XIX века
view picture please!!!!
Lu VES you I like someone
We meet a new character who is associated with Chauvelin in this portion of the novel; what is his job and why is his role in the text important?
Banks and other financial institutions sometimes calculate simple interest based on: