s689003
s689003 s689003
  • 11-03-2021
  • Biology
contestada

What is the complementary strand of DNA to the one below?
AAACCGTATCCGCGGTATATCGCCGGAAT

Respuesta :

nsjwjwiaoaosksjja
nsjwjwiaoaosksjja nsjwjwiaoaosksjja
  • 11-03-2021
lick me , tease me , touch me , please me






AHAHA SORRY
Answer Link
yolzz
yolzz yolzz
  • 05-04-2021

Answer:

TTTGGCATAGGCGCCATATAGCGGCCTTA

Answer Link

Otras preguntas

Write the fractions 5/10,5/100,5/1,000 as decimals. How are the decimals related
How did the university rector react to the students’ demands?
how is the sentence 8 less than y is 2 written as an equation
500 reduced by 4 times my age is 100 what is my age
Write the chemical symbols for three different atoms or atomic anions with 35 electrons.
explain how you would estimate to subtract 189 from 643
An electromagnetic radio wave is received by a transmitter before it is converted to a sound wave. The radio wave has a wavelength of 23,076 m and a frequency
Whose opinion and beliefs have the greatest effect on how you think about your own identity
Which describes the tendency to focus on the negative and expect the worst?
How do you factor: 12x^2-4x-40