qiaradania07 qiaradania07
  • 14-03-2021
  • Mathematics
contestada

what is the answer of
b2 - 81 ?
​

Respuesta :

lebavabi lebavabi
  • 14-03-2021

Answer:

2(b-40.5)

Step-by-step explanation:

2(b-81) therefore 2 is the HCF(Heighest common factor)

u have to divide both terms by 2

(2b÷2)-(81÷2)

2(b-40.5)

Answer Link

Otras preguntas

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
I don t have any questions but
Ribosomes are like tiny “factories” within cells that do all of the following EXCEPT
EASY AND 12 POINTShow to lose fat (stomach)
Which number best represents a temperature drop of twelve degrees? A. -1.2 B. 1.2 C. -12 D. 12
In the front of the room, there is a bottle that contains a 32.00 g sample of sulfur. This is 1 mole of sulfur. Estimate how many atoms are in the bottle.
what is the molecular formula of the molecule thay has an empirical formula of CH20and a molar mass of 240.2 g/mol?​
about pythagorean theorem, really need help!
Select the correct answer. A farmer has been growing the same crops in his field summer and winter, year after year. Over time, the soil has lost a lot of its m
Can someone help me pls