CIsabellaC CIsabellaC
  • 16-05-2021
  • Mathematics
contestada

Cuantos años hay 5823 días

Respuesta :

mmart233
mmart233 mmart233
  • 16-05-2021

Answer:

16 anos

Step-by-step explanation:

Answer Link

Otras preguntas

v=u + at u= 2 a= -5 t = 1/2 Work out the value of v.
What is -2-(-7) Plsss explain
Complete the chemical name of the compound Col3. Use the periodic table to help form your answer. Type the correct answer in the box. Spell all words correctly.
I will give you the brain thing and extra points. (image below) 6/13
An effective end to a narrative should include what two elements (hint: plot)?
Replication, Transcription, and Translation Chart Please answer DNA Replication: 1。Template Strand: Start with this nucleotide chain. TACCCTTGAATAAAAAATCTCTGTTT
A mercury thermometer records a temperature of 10°F at 9 a.m. If the temperature drops by 3°F every hour, what will be the temperature by 2 p.m.?​
Emma drank 3/4 liter of water before her jog. She drank 3/5 when she got back from her jog. How much water did emma drink altogether? Answer as a mixed number
Analyze the chart below and answer the question that follows. Data courtesy of the Oklahoma Dept. of Commerce According to the chart above, what percentage of O
pls help question 2 ill attach a picture​