sjohnson922989 sjohnson922989

11-11-2021
Mathematics

contestada

Please help!!!!!!!!!!!

Please help class=

Respuesta :

Ashlynnisfunny Ashlynnisfunny

11-11-2021

Answer:

10. right triangle 11. obtuse triangle 12. right triangle 13. right triangle

Step-by-step explanation:

Answer Link

Otras preguntas

What was the first major advance of the United States and the other Allied powers? a) Battle of Kursk b) Operation Barbarossa c) Operation Torch d) Battle of

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

Given the following functions f(x) and g(x), solve (f ⋅ g)(3) and select the correct answer below: f(x) = 4x^2 + 12 g(x) = x − 1 47 −47 96 −96

Calculate 2007-03-04-00-00_files/i0080000.jpg% tax on $1,540. a. $11.17 b. $109.34 c. $111.65 d. $113.96

please help me please!!

Explain the arms race between the United States and the Soviet Union

While on the subway, montag struggles to absorb the biblical passage of matthew 6:28, which implores readers to forget about material possessions and to "consid

In "Everyday Use," the author describes Maggie as "chin on chest, eyes on ground, feet in shuffle." Which sentence about Dee (Wangero) provides contrast to thes

Who trained the American troops? A. Baron von Steuben B. Jean-Jacques Rousseau C. Thomas Jefferson D. Ben Franklin

Danielle plotted 3 points from the equation y = 4x on this coordinate grid. She drew a straight line through the points. Which ordered pair would also be on th