15-11-2021
Health

contestada

Bullying is the same as getting mad and fighting someone.

True Or False?

Respuesta :

flowercrystal10 flowercrystal10

15-11-2021

Answer:

True

Explanation:

Answer Link

Otras preguntas

pattern explanation 5,3,9,7,21

The rectangle below has an area of 70y^8+30y^670y 8 +30y 6 70, y, start superscript, 8, end superscript, plus, 30, y, start superscript, 6, end superscript.

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

In x years from now, Robert will be k years old. How old was Robert m years ago? A) x-(k+m) B) k-x C) k-x-m D) x-(k-m)

(2) How do unsocial people take undue advantage of a calamity?

What is a sentence example with Factor of Production

. Using the Converse of the Same-Side Interior Angles Postulate, what equation shows that g || h? 1 3 2 4 -g -h

Factorise: x² + 6x - 16

The height of the Ferris wheel in feet can be represented by the function 50 cos ((-10))+52 with time in seconds. When does the height of 80 feet occur on the i

Can I ask a rhetorical question in a formal essay?