BlacBull BlacBull
  • 13-01-2022
  • Mathematics
contestada

Kathy has 30 coins, consisting of dimes and quarters that total $5.10. How many coins of each type does she have?

Respuesta :

Vance06 Vance06
  • 13-01-2022
The answer is 92 because that is what it is
Answer Link

Otras preguntas

what is the complementary DNA of TACCGGATGCCAGATCAAATC?
Which number is a rational number? A. √15 B. 2.645713110... C. 17.156 D. 3√85
1) Drop the er/ir 2) Add the ending based on the subject Write the correct forms of the given verbs 3. leer: to read Tú Carmen Elena y Ana Juan Tina y yo 4. beb
They didn't reach an agreement their differences. on account of due. because owing
Can someone help me on questions 1 and 2
The fuel oils and coal are classified as
Which types of narrators do you think authors would use when writing about the Cuban Revolution? Select all of the narrator types that you believe would be appr
Which of the following statements is FALSE? A. Summarizing involves presenting the essential points of information. B. Paraphrasing is restating or putting idea
A car dealership sold 950 cars last year. This year the dealership sold 817 cars. What is the percent decrease in the number of cars sold from last year to this
Please, help! Help! Help!