starryakaashi starryakaashi

15-01-2017
Health

contestada

is heredity considered a controllable risk factor? (true or false)

Respuesta :

Krazy1111 Krazy1111

15-01-2017

it would be false I would say

Answer Link

Dest19742 Dest19742

15-01-2017

heredity is not a controllable risk but there are small chances that you could get a certain trait

Answer Link

Otras preguntas

Phosphatidic acid is a precursor for the lipid class(es): a) Triacylglycerides b) Sphingolipids c) Glycerophospholipids d) A and B e) A and C

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA

Bjork Larsen was trying to decide whether to use a new racing wax for cross-country skis. He decided that the wax would be worth the price if he could average l

What does control mean in biology?

What response is appropriate when a client with hypertension declines to take prescribed antihypertensive medications because due to the absence of symptoms?

Identify any solutions to the system given below. 2x + y = 5 3y = 15 - 6x

Does potassium nitrate (KN03) incorporate ionic bonding, covalent bonding, or both? Explain.

How does skin defend the body against pathogens

A seven digit telephone number is of the form ABC-DEFG. In one particular state, the digit ‘A’ is restricted to any number between 3 and 9. The digits B and C a

What degree is required to become a radiation technologist?