25roev05 25roev05
  • 11-02-2022
  • Biology
contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570
10818570 10818570
  • 11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

After being rearranged and simplified, which of the following equations could be solved using the quadratic formula?
Which of the following inventions destroyed the first market for petroleum?
Which of the folowing expressions means i need to or i have to
The colon is not used to for __________. A. lists B. appositives C. long quotations D. omission Please select the best answer from the choices provided A B
Complete each sentence below with the correct form of ser or estar. Yo ____________________ muy cansado.
You can buy 20 fluid ounces of shampoo for $4.40 or 24 fluid ounces for $4.80. Which is the better buy? Explain. please explain ihave test tommorow!
((Picture) CONVERGENT AND DIVERGENT SERIES PLEASE HELP!!
which is not a major cause of russian weaknesses in the mid 1800
If lines l and m are parallel, then ∠2 and ∠3 are _______ angles.
how could you use 1/4 cup measuring cup to measure the water of 3/4 of a cup