jeremiahmahone15 jeremiahmahone15

14-05-2022
Biology

contestada

A are organisms whose bodies change to the environment.
Conformer
Prokaryote
Regulator
Mammal

Respuesta :

tristiantapia tristiantapia

14-05-2022

Answer:

its none of the above is ectotherms

Answer Link

Otras preguntas

Tarush in landscape architect 1st public project yes to curry a small scale drawing of a garden to be placed in the corner of city park the garden is right tria

PLZ HELP MEE During photosynthesis, water and carbon dioxide react to form oxygen and glucose. Explain how to products differ from the reactants of photosynthes

First Printing has contracts with legal firms in San Francisco to copy their court documents. Daily demand is almost constant at 12,500 pages of documents. The

A major weakness of the information-processing perspective is that it: a. fails to use rigorous research methods. b. virtually ignores aspects of cognitive th

whats a internal conflict for the book,Mrs. Frisby and the rats of NIHMPLEASE HELP 20 BUCKS AND I'LL MARK THE BRAINLYIST

Given the Boolean function: F(x,y,z)=x' y + xyz', derive an algebraic expression for the complement of F. Express in sum-of-products form. a. (x'y + xyz')' = xy

Find the volume of a cone with a base radius of 6ft and a height of 6ft. Write the exact volume in terms of PI, and be sure to include the correct unit in your

what is the final sum of 3(4+9) = ?

What is the value of log Subscript 625 Baseline 5?

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to d