sabikunnahar4288 sabikunnahar4288

14-01-2024
Mathematics

contestada

What does This expression represents?

What does This expression represents class=

Respuesta :

georgepahno georgepahno

14-01-2024

Answer:

This expression represents a quadratic polynomial, which has 2 terms. The constant term is -1.

Answer Link

Otras preguntas

Read the passage below and answer the question. Somehow, it was hotter then: a black dog suffered on a summer’s day; bony mules hitched to Hoover carts flicked

A rectangle's length is 6 units greater than its width. write an equation expressing the rectangle's area, a, as a function of w usatestprep

Why was there a need for expansion into the Pacific Ocean? A. Steamships needed a place to refuel. B. Small tribes were in constant need of care. C. Governments

if (-3)^-5=1/x what is the value of x Answers: -243 -1/243 1/243 243

you are watching a commercial that encourages viewers to send money to build wells in poor villages in Africa. The commercial contains text that state, "water i

PLEASE ANSWER + BRAINLIEST !!! According to Freud, which part of the unconscious mind would be responsible for giving food to the needy? A. The Id B. The Ego C.

a visual display in which the frequency of each piece of data is represented by a dot on a number line

Eduardo has 27 cubic feet of wood chips to use for a new path in a garden. The chips must be 6 inches deep, and the path is 3 feet wide. How long can a path be?

what is the safe order in writing an essay

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg