maryramirez4 maryramirez4

15-04-2024
Mathematics

contestada

Rosie combined 1 3/4 gallons of cranberry juice and 3/4 gallon of apple juice to make
fruit juice. How many gallons of fruit juice did Rosie make with the cranberry juice
and apple juice?

Respuesta :

Otras preguntas

NEED HELP 13 MIN LEFT How did Muslims demonstrate religious tolerance to Jews and Christians? Jews and Christians were allowed to spread their own beliefs. Jews

biology is amazinggggggg

Roller coasters accelerates from initial speed of 6.0 M/S2 final speed of 70 M/S over four seconds. What is the acceleration?

A 9.0 kg test rocket is fired vertically from Cape Canaveral. Its fuel gives it a kinetic energy of 1905 J by the time the rocket engine burns all of the fuel.

Which of the following is an example of a PRIMARY RESOURCE? 1. An interview provided by a Japanese American detailing her experiences during World War Two 2. Ou

What is contract in music? 1. similarity 2. procedures 3. connections 4. difference

someone. play. duos. in. fort. with. me. rn. thanks.

What is the quotient of 4.8 divided by -0.4

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

When determining an element's identity, what is the most important subatomic particle to examine