susgrace susgrace

12-01-2020
Mathematics

contestada

ben is 39 and joe is 3, how many years will it take until ben is 4 times as old as joe?

Respuesta :

bumorhumor bumorhumor

12-01-2020

It would be -27 years ago because 39+x=3(4)

Answer Link

elijahleee elijahleee

12-01-2020

9 , because in 9 years joe will be 12 , and ben will be 48 , 48/12 = 4

Answer Link

Otras preguntas

List all the terms in the expression, 3x + 5x – 2. Group of answer choices 3x , 5x, and -2 3 and 5 x and x and -2 3, 5, and -2 Thx!

why did the candy bomber drop candy

Fill in the blank to make the two fractions equivalent. ?/27= 4/9

3,286-(1,221+217)…….

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

Ejemplo de oración interrogativa

1. 50x2= 2. 60x3= 3. 75x8+3= And then add then all together

Select all the correct answers. Which values are included in the solution set of this inequality? 2x² - 1 > 6xx=1x=3x= -2x=5x= -4

Which of the following statements describes the Civil War? OA. The Civil War was the only war that lasted more than three years. B. The Civil War cost more mone

GIVING BRAINLIEST & 30 POINTS! (please do the math and don't use other sources I know answering this question means nothing to you other than points but jus