bvbytaye bvbytaye

16-02-2021
History

contestada

What kind of speech uses words that are extremely abusive and provoke someone to take action

Respuesta :

aalmo006 aalmo006

16-02-2021

Answer:

Symbolic Speech

Explanation:

Answer Link

Otras preguntas

I have this assignment on the movie The Founder, i need 6 marketing terms/techniques that were used in the movie, and the meaning. does anyone have any good mar

is an integer. Given that the value of lies between between 29 and 39 Write down the value of .

Tanisha has 51 m of fencing to build a three-sided fence around a rectangular plot of land that sits on a riverbank. (The fourth side of the enclosure would be

Cut 2-4cm of magnesium ribbon. this sentence change into past passive tense?

Three sisters each purchase a dress of equal value. One of the sisters purchased a purse for $26.00. If the grand total was $249.50, how much did each dress cos

Those who were members of Stalin's representatives at the genocide convention may have had to fill questions about the millions of Ukrainians who starve to deat

The sum of three numbers is 68. The first number is 8 more than the second. The third number is 2 times the second. What are the numbers?

1. Mention the 4 methods of separation. Explain each method with diagrams and give suitable examples.

George decides to put away $200 a month for 20 years. If he chooses to put it into an annuity paying 6% interest compounded monthly how much would he end up wit

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated