kaitlynderouchie kaitlynderouchie

12-09-2022
English

contestada

The theme in all Summer in a day, but it need to be described

Respuesta :

rainstormxo rainstormxo

12-09-2022

Two themes in ‘All Summer In A Day’:

- People can be cruel to one another because of prejudice.
-Treat others the way you would like to be treated.

Answer Link

Otras preguntas

Though the Inacs lacked wheeled tools and draft animals, their economy was based primarily on

A firm will borrow long-term A. if the extra interest cost of borrowing long-term is less than the expected cost of rising interest rates before it retires its

Which of the following is a result of the construction of a median of a triangle? An angle of the triangle is bisected. A perpendicular segment is created from

Four students tried out for a softball team. Each student threw the ball from the pitcher’s mound to home plate. The coach recorded how many seconds it took eac

What is the relationship between the price level and the following components of aggregate demand. a. There is relationship between the price level and consumpt

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

When deciding which brands to consider, a(n) _____ refers to those options that consumers want to choose among. Select one: a. inert set b. equivalent set c.

Why do countries specialize? Check all that apply.a) to produce more of certain goods and services in a more efficient wayb) to trade with one another for goods

Darren is trying to get his young son to eat his peas. At first, Darren praises him whenever he moves his fork near the peas; after the child does this reliably

- dll the correct answers. Which two characteristics of living things do viruses exhibit? 3 They have genetic material. They increase in size over time. They ar